This Document Contains Chapters 13 to 15 CHAPTER 13: DNA: THE CHROMOSOMAL BASIS OF INHERITANCE WHERE DOES IT ALL FIT IN? Chapter 13 revisits and builds upon the principles of meiosis and sexual reproduction. It introduces students to the value of understanding how chromosomes and epigenetic factors relate to cell function. The information covered in Chapter 13 is important for understanding the principles of evolution covered later in the textbook. The concepts mentioned in this Chapter should be reviewed when covering the molecular biology of DNA information introduced in Chapter 14. SYNOPSIS Mendel was fortunate that he chose straight forward traits. The inheritable characteristics he studied made it simple to calculate the predictable probabilities of gene expression in offspring. However, there are more complex genetic patterns associated with continuous variation, pleiotropic genes, lack of complete dominance, environmental modifications of genes, and epistasis. Many human genetics disorders follow Mendelian principles. Most are recessive like Tay-Sachs disease. Hunington’s disease is an example of a dominant allele that remains in populations because its effect is not expressed until after children are born. Human blood groups are an example of traits stemming from multiple alleles. In the ABO system, four phenotypes arise from the combination of three alleles coding for red cell surface antigens. The transmission of a genetic disorder can often be tracked through pedigree analysis, shown in example by Royal hemophilia in the lineages of the British monarchy. Disorders like sickle-cell anemia, are a result of nucleotide changes that alter the linear and three-dimensional structure of critical proteins. Current genetic research uses molecular techniques to try to cure disorders like muscular dystrophy by inserting new genes into disabled cells. Modern geneticists have modified Mendel’s laws to be consistent with discovery of meiosis and crossing over, identification of chromosomes as hereditary material, and the structure of genes and DNA. Genetic crosses in which recombination is evident can be used to construct gene maps, identifying the location of alleles on chromosomes and specific positions within chromosomes. The Human Genome Project has produced vast amounts of data elucidating the genetic sequence of our own genome. A normal human cell possesses twenty-two pairs of autosomal and one pair of sex chromosomes for a total of forty-six chromosomes. Any variance from that number is detrimental and often lethal. Down syndrome, one of the few non-lethal trisomies, results from primary nondisjunction during meiosis. Abnormal separation of the sex chromosomes can result in individuals with extra or absent X or Y chromosomes. The minimal amount of sex chromatin needed for survival is a single X chromosome. A YO zygote fails to develop as the Y lacks the necessary information present on the X. Genetic counseling attempts to prevent the production of children with genetic disorders by identifying parents at risk. Prenatal diagnosis is valuable and uses amniocentesis, ultrasound, and/or chorionic villi sampling. Mendel did not have an understanding of epigenetic factors that influence an organism’s characteristics. Eukaryotic cells are now known to be influenced by the genetic information carried in chloroplasts and mitochondria. These organelles can contribute to or modify gene expression of the cell’s genomic DNA. They are also subject to genetic variation that produces genetic disorders inherited by transfer of the organelle during gamete formation. LEARNING OUTCOMES 13.1 Chromosomes Are the Vehicles of Mendelian Inheritance 1. Demonstrate how white eye color in flies segregates with the X chromosome. 2. Explain the relationship between sex determination in mammals and the occurrence of dosage compensation. 13.2 Assortment of Some Genes Is Not Independent: Linkage 1. Explain why recombination frequency is related to genetic distance. 13.3 Genetic Crosses Provide Data for Genetic Maps 1. Construct a genetic map using data from a testcross with linked genes. 13.4 Changes in Chromosome Number Can Have Drastic Effects 1. Describe nondisjunction and its consequences in humans. 13.5 Chromosomal Inheritance in Humans Is Studied by Analyzing Pedigrees 1. Demonstrate how modes of inheritance can be analyzed using pedigrees. 2. Contrast the inheritance of hemophilia, sickle-cell disease, and Huntington disease. 3. Describe three things geneticists examine in cells obtained by amniocentesis. 13.6 There Are Two Major Exceptions to Chromosomal Inheritance 1. Explain how genomic imprinting leads to non-Mendelian inheritance. 2. Explain how mitochondrial and chloroplast DNA lead to non-Mendelian inheritance. COMMON STUDENT MISCONCEPTIONS There is ample evidence in the educational literature that student misconceptions of information will inhibit the learning of concepts related to the misinformation. The following concepts covered in Chapter 13 are commonly the subject of student misconceptions. This information on “bioliteracy” was collected from faculty and the science education literature. • Students have trouble distinguishing chromatin from chromosomes • Students do not fully understand the role of genetics and environment on determining observable variation in organisms • Students believe acquired characteristics can be inherited • Students think that all genetic disorders are homozygous recessive • Students believe that inbreeding causes genetic defects • Students do not take into account the role of crossing over in classical inheritance variation • Students believe that gender in all organisms is determined by X and Y chromosomes • Students confuse the roles of autosomes and sex chromosomes • Students do not associate gene expression with inherited characteristics • Students believe sexual reproduction always involves mating • Students do not understand other mechanisms of sexual reproduction besides mammalian reproduction • Students are unaware of the impacts of chloroplast and mitochondrial DNA on eukaryotic traits INSTRUCTIONAL STRATEGY PRESENTATION ASSISTANCE This chapter covers the principles and applications of chromosome theory and epigenetics. It is important to review cell structure and reinforce the locations of chromosomes and organelles involved in trait expression. Examination of sex chromosome abnormalities is an excellent chance to review meiosis, in terms of determining at what point of gametogenesis each nondisjunction occurs. One may want to discuss the sex chromosome tests associated with Olympic sports competition. There are recent developments concerning the identification of a genetic marker associated with Huntington’s disease. It may be worthwhile to discuss the moral and ethical implications of genetic therapy. Would you want to know whether or not you were going to develop the disease? Or perhaps worse, your children? Recent psychiatric studies show that those tested as possessing the gene for Huntington’s disease do not become significantly depressed when faced with the news. Rather, they are less depressed than those who have not been tested or whose tests are inconclusive. (Southern blot/probe tests are 95% to 98% accurate in identifying this gene.) Genetics have been implicated in autoimmune diseases like multiple sclerosis and lupus as well. There’s a very interesting article on “genomic imprinting” in the December 1997 issue of Equus. The authors present the phenomenon of paternal imprinting as the reason that certain Thoroughbred sires are quality racehorses themselves, sire barely better-than-average progeny, but whose daughters produce again superb quality racehorses. They cite Secretariat as a most evident example. HIGHER LEVEL ASSESSMENT Higher level assessment measures a student’s ability to use terms and concepts learned from the lecture and the textbook. A complete understanding of biology content provides students with the tools to synthesize new hypotheses and knowledge using the facts they have learned. The following table provides examples of assessing a student’s ability to apply, analyze, synthesize, and evaluate information from Chapter 13.
Application • Have students predict the genetic probabilities of color blindness or other sex-linked disorders. • Have students explain the impacts of inbreeding on contributing to the presence of genetic disorders in a population. • Ask students to explain produce a pedigree of family produced by a couple who both exhibit a mitochondrial disorder.
Analysis • Have students explain the factors that contribute to a large degree of nondisjunction in the ovaries of older females. • Ask students to identify the most likely stage of meiosis that would produce disorders in which a zygote has fewer or extra chromosomes. • Ask students to explain a strategy for breeding pure populations of plants that have chloroplasts with valuable genetic characteristics.
Synthesis • Ask students to come up with a way that a physician could determine if a disease is caused by a sex-linked gene or by mitochondria. • Have students explain how a person appearing female could develop from an XY zygote. • Ask students to predict the outcomes of accidental X-chromosome inactivation in a male.
Evaluation • Ask students evaluate the pros and cons of testing all people for Huntington’s disease. • Ask students to evaluate the ethical implications of testing a fetus for nondisjunction disorders. • Ask to explain the pros and cons of a drug blocks the function of the gene responsible for Huntington’s disease.
VISUAL RESOURCES It is important to use large visual models of chromosomes to demonstrate chromosomes changes that produce the genetic disorders covered in this chapter. Diagrams or models of chloroplasts and mitochondria are also important to refresh the class’s knowledge of these organelles. Projected images or photographs of animals and plants expressing genetic mosaics and epigenetic factors are very useful. It is also helpful to provide students with images of the human genetic disorders described in this chapter. IN-CLASS CONCEPTUAL DEMONSTRATIONS A. Virtual DNA Extraction Introduction This fun and fast demonstration engages students in developing a human karyotype. The click and drag animation allows the instructor to interact with students while selecting chromosomes to build a karyotype diagram. Materials • Computer with live access to Internet • LCD projector attached to computer • Web browser with bookmark to Learn Genetics DNA Extraction animation at: http://learn.genetics.utah.edu/units/biotech/extraction/ Procedure & Inquiry 1. Introduce the idea of knowing how to extract DNA as a means of identifying DNA sequences. 2. Pull up Learn Genetics DNA Extraction website. 3. Start the sequence by clicking on the start button. 4. It may be necessary to read the pop-up reading material to the class. 5. Ask the students to answer the questions appearing in the pop-up reading. B. Dance of Nondisjunction Introduction This visual activity is a fun way to demonstrate nondisjunction. It particularly focuses on the DNA separation errors of meiosis that lead to nondisjunction. Materials • 4 student volunteers • 8 large swimming “pool noodles” representing homologous chromosomes • Four noodles of one color (Color A) • Two are labeled chromosome 1 • Two are labeled chromosome 2 • Four noodles of another color (Color B) • Two are labeled chromosome 1 • Two are labeled chromosome 2 Procedure & Inquiry 1. Review the basic principle of nondisjunction. 2. Call 4 students to the front instruct the following: a. One students holds Color A chromosome 1 b. One students holds Color B chromosome 1 c. One students holds Color A chromosome 2 d. One students holds Color B chromosome 1 3. Ask the class to explain what the students need to do to represent the genetic conditions of the DNA after the interphase of meiosis. 4. Then have the students take the duplicate chromosome and holding one chromosome in each hand. 5. Then ask the class to explain what the students need to do to represent the genetic conditions of the DNA during metaphase of meiosis I. 6. Then ask the students holding the noodles to represent how nondisjunction would occur during anaphase of meiosis I. 7. You or the class can redirect the students to demonstrate the concepts more accurately if necessary. LABORATORY IDEAS This activity provides a model for demonstrating polygenic traits. It uses the random tossing of pennies to show students that polygenic traits are controlled by more than one gene. The demonstration can be adapted to discussions on the genetics of hair color, height, skin color, and weight. a. The following materials should be provided to a small group of students: a. Six pennies per group of students b. A piece of paper to tally the results b. Explain to the students that polygenic traits such as weight are due to the percentage of dominant and recessive alleles in several sets of genes. c. Then tell them that these traits can be calculated by evaluating the number of dominant genes compared to the number of recessive. d. Then instruct the students to model the polygenetic inheritance of height using coins to represent the alleles of six sets of genes. Heads represents the dominant characteristic, whereas tails is the recessive allele. e. Ask each group of students to flip all six coins on the lab table at once. f. Have the students record the number of heads and tails and calculate the phenotype using the rubric below:
PRIVATE Penny Toss Approximate Height
0 Tails and 6 Heads 6 feet 1 inch
1 Tail and 5 Heads 5 feet 11 inches
2 Tails and 4 Heads 5 feet 9 inches
3 Tails and 3 Heads 5 feet 7 inches
4 Tails and 2 Heads 5 feet 5 inches
5 Tails and 1 Head 5 feet 3 inches
6 Tails and 0 Heads 5 feet 1 inch
g. Ask the student to conduct the tossing twenty times to calculate the percentage of each phenotype after the twenty mating trials. Inform them that the tosses represent parents heterozygous for height. h. Have the students compare their data to other students. They should be asked to make conclusions about the diversity of characteristics for hair color, height, skin color, and weight that would be available in populations of people heterozygous for those characteristics. LEARNING THROUGH SERVICE Service learning is a strategy of teaching, learning and reflective assessment that merges the academic curriculum with meaningful community service. As a teaching methodology, it falls under the category of experiential education. It is a way students can carry out volunteer projects in the community for public agencies, nonprofit agencies, civic groups, charitable organizations, and governmental organizations. It encourages critical thinking and reinforces many of the concepts learned in a course. 1. Have students present a public forum on the benefits and risks of genetic testing for inherited disorders. 2. Have students design an educational animated PowerPoint presentation on genetic disorders for middle school teachers. 3. Have students tutor middle school or high school biology students studying genetics. 4. Have students present literature on the biology of genetic disorders for a booth at a health fair. ETYMOLOGY OF KEY TERMS di- two; twice (from the Greek di- two) bi- two (from the Latin bi- two) hetero- different (from the Greek heteros- the other of two) homeo- likeness; resemblance; similarity (from the Greek homoios- like) extra- outside; beyond (from the Latin exter- being on the outside) mono- one; single; alone (from the Greek monos- alone) phenotype observable traits (from the Greek phainein- to show and typos type CHAPTER 14: DNA: THE GENETIC MATERIAL WHERE DOES IT ALL FIT IN? Chapter 14 takes the general principles of inheritance and looks deeper at the molecular structure of DNA. It also provides the basic foundations for understanding protein synthesis. This chapter is a connector for Chapters 13 and 15. So, it is important that students have a fresh understanding of Chapters 13 and 14 before moving into the molecular biology of genetics coverage. This information is also critical for building a picture of the mechanisms driving natural selection. SYNOPSIS Scientific advances are a result of proper experimental design mixed with insight and a little luck. The events leading to the discovery of DNA as the material of heredity are especially good examples of how individual experiments build upon one another to answer a larger scientific question. Among the first experiments were those that indicated that the hereditary material was stored within the nucleus of every cell. Although this now seems intuitive, there are many structures within a cell that segregate during meiosis other than the chromosomes. The role of the nucleus was further clarified by observing embryonic development after physical manipulation of the nucleus. Several different kinds of experiments were performed to prove that the hereditary material was nucleic acid rather than protein. Among these were the Griffith and Avery experiments in which nonvirulent bacteria were made virulent by a nonprotein-transforming principle. The Hershey Chase experiments indicated that it was the DNA within viruses and not their protein exteriors that was the infecting material that killed bacteria. Chemical analysis of nucleic acids illustrated their structure but did not hint as to how these units were assembled into a working blueprint. Chargaff determined that DNA was not a simple repeating polymer and that the proportions of the adenine and thymine nitrogenous bases were always equal as were the proportions of guanine and cytosine. X-ray diffraction of impure samples of DNA by Rosalind Franklin gave Watson and Crick sufficient information to construct their three-dimensional model of the DNA molecule. A key point of the model was the complementarity of the DNA strands, a result of the bonding of their bases, adenine to thymine and guanine to cytosine. The Watson-Crick DNA model consists of two complementary phosphodiester strands wound around each other forming a double helix. The two phosphodiester strands are anti-parallel with the bases oriented within the molecule. The two strands are held together by hydrogen bonds forming between the complementary bases. The Meselson Stahl experiments began to explain DNA replication by determining that it was a semiconservative process; each strand served as a template for the production of a new one and each old and new strand then intertwined to become a new helix. DNA replication is a complex process involving many enzymes (DNA polymerases, primase, helicase, ligase, etc.). At the replication fork, several of these enzymes form a complex assemblage known as the replisome. Furthermore, double-stranded DNA replication is complicated since new nucleotides must be added to both the 5’ to 3’ strand and the 3’ to 5’ strand at the same time, but DNA polymerase can only add onto the 3’ end. The 5’ to 3’ or leading strand is replicated simply by adding nucleotides as the old strands unzip. The 3’ to 5’ lagging strand is replicated in batches via discontinuous synthesis. Segments called Okazaki fragments are made in the usual way. These fragments are then connected by phosphodiester bonds by DNA ligase. Since one strand is processed continuously and the other discontinuously, replication as a whole is semi-discontinuous. The relationship between DNA and proteins was determined by Beadle and Tatum using nutrient deficient strains of mold. They found that each mutated gene was responsible for the production of a single enzyme in a biochemical pathway and postulated the one gene-one enzyme hypothesis. Later experiments showed that the proteins coded for by DNA were composed of amino acid units strung together; somehow the sequence of DNA was related to the protein sequence of amino acids. LEARNING OUTCOMES 14.1 DNA Is The Genetic Material 1. Explain Griffith’s transformation experiment. 2. Describe how Avery’s work demonstrated that DNA was the transforming principle. 3. Compare the findings of the Hershey-Chase experiment and the Avery experiment. 14.2 The Molecule Is a Double Helix 1. Identify the four DNA nucleotides. 2. State Chargaff’s findings on relative abundances of the four bases. 3. Explain the importance of Franklin’s x-ray diffraction picture. 4. Illustrate Watson and Crick’s proposed structure for the DNA molecule. 14.3 Both Strands Are Copied During DNA Replication 1. Relate the results of the Meselson-Stahl experiment to possible modes of DNA replication. 14.4 Prokaryotes Organize the Enzymes Used to Duplicate DNA 1. Describe the enzymes used to synthesize DNA. 2. Explain why DNA synthesis is not continuous on both strands. 3. Diagram the functioning of the bacterial DNA replication organelle. 14.5 Eukaryotic Chromosomes Are Large and Linear 1. Compare eukaryotic DNA replication with prokaryotic DNA replication. 14.6 Cells Repair Damaged DNA 1. Compare and contrast specific and nonspecific forms of DNA repair. COMMON STUDENT MISCONCEPTIONS There is ample evidence in the educational literature that student misconceptions of information will inhibit the learning of concepts related to the misinformation. The following concepts covered in Chapter 14 are commonly the subject of student misconceptions. This information on “bioliteracy” was collected from faculty and the science education literature. • Students have trouble distinguishing chromatin from chromosomes • Students do not fully understand the role of genetics and environment on determining observable variation in organisms • Students are unfamiliar with the roles of the two different DNA strands • Students are unaware of the chemical differences between nucleic acids and proteins • Students are unaware of the role of viral DNA in the host cell • Students commonly confuse the complementary base pairs • Students do not associate base pair sequence with DNA function • Students believe prokaryotic and eukaryotic DNA structure and function are identical • Students do not understand that DNA replication produces a discontinuous strand • Students believe that X-ray crystallography produces a visible double-helix image of DNA INSTRUCTIONAL STRATEGY PRESENTATION ASSISTANCE This chapter illustrates the additive effects of scientific discovery and the need for scientists to openly communicate with one another (i.e., publish) very well. Mendel, Darwin, and Einstein are rare exceptions in the scientific world. Even Watson and Crick used someone else’s data to derive their model of DNA. There are a lot of names presented in this chapter. Most of them are important within the historical construct of biology. Plus it is much easier to describe an experiment as “The Griffith Experiment” than to talk about the experiment that used virulent bacteria and so forth. After all, if psychology students learn about Skinner, and English students about Emily Dickinson, why can’t biology students be familiar with a few of the biggies in their field? Students frequently get confused with directionality in the DNA helix even though it seems simple that one strand runs 5’ to 3’ and the other 3’ to 5’. They also expect one strand to always be the sense strand. Sense strand recognition is explained in the next chapter. Students also become confused with the many enzymes involved. A clear demonstration of the function of each enzyme may be necessary for the average student to completely understand the process. This may be done simply by writing a series of bases on the board, indicating where phosphodiester bonds link adjacent nucleotides. Next, write the complementary strand, starting with “RNA” bases. Demonstrate how DNA pol I “removes” the primer and “fills the gap” with DNA bases. Finally, demonstrate how DNA ligase seals the strand by connecting adjacent nucleotides. Many students confuse nucleotide base names with amino acid names (i.e., thymine and thymidine). Some hints just in case students can’t seem to keep the mechanisms of base pairing straight: (1) A and T are both angular letters and with the addition of U, they have an upright orientation. C and G are curved letters and both open toward the right. (2) A and G are in the same class and both have horizontal lines in their middles. (3) Structurally, the class of base with the shorter name (purine) is larger (having a double ring) while the longer name (pyrimidine) is the smaller molecule. HIGHER LEVEL ASSESSMENT Higher level assessment measures a student’s ability to use terms and concepts learned from the lecture and the textbook. A complete understanding of biology content provides students with the tools to synthesize new hypotheses and knowledge using the facts they have learned. The following table provides examples of assessing a student’s ability to apply, analyze, synthesize, and evaluate information from Chapter 14.
Application • Have students predict the type of DNA replication carried out by chloroplasts and mitochondria. • Have students design an experiment showing the presence of semiconservative replication. • Ask students to design a synthetic DNA molecule that can be used to block replication of a DNA strand containing the sequence: ATTCGCCCATTATCCCCGCAATCCCATTATC.
Analysis • Have students explain the differences and similarities between prokaryotic and eukaryotic DNA replication. • Ask students to determine the how nondisjunction diseases would affect DNA replication. • Ask to explain the effects of a disease that disrupts the DNA repair system.
Synthesis • Ask students to determine if prokaryotes would be capable of producing eukaryotic enzymes after inserting a gene for that enzyme. • Have students explain what factors need to be considered when putting eukaryotic DNA into a prokaryote. • Ask students come up with a commercial use for replisomes.
Evaluation • Ask students to evaluate the use of a chemical that stops the discontinuous part of DNA replication. • Ask students to determine the safety of antibacterial drug that causes a cell to replace adenine with cytosine. • Ask to evaluate the effectiveness of a drug claimed to reducing DNA by speeding up the activity of the DNA repair system.
VISUAL RESOURCES One could construct all sorts of interesting visual aids associated with DNA replication using zippers and/or Velcro®. The latter would be especially useful to show semiconservative replication using different color strips as it sticks together quickly and pulls apart almost faster. (We all know how zippers get stuck at the most inopportune moments.) Velcro® sewn into a circle would also illustrate bacterial DNA replication readily. One circle should be simply basted so it can be “nicked” easily. Sigma sells an interesting, humorous, albeit slightly juvenile book called BIOKIT: A Journey Into Life that may give you some ideas regarding presentation of this material to very inexperienced students. Variously colored pop-it beads are handy for showing nucleotide and amino acid sequence. IN-CLASS CONCEPTUAL DEMONSTRATIONS A. Replicating Students Introduction This fun and fast demonstration engages students in demonstrating the process of semi-discontinuous replication in eukaryotes. It uses student input to design the sequence the events of DNA replication. Materials • 2 Student volunteers • Large black marker • 48 sheets of 8 1/2 “ by 11” white paper representing nucleotides ○ 10 sheets labeled with a large black “A” ○ 10 sheets labeled with a large black “C” ○ 10 sheets labeled with a large black “G” ○ 10 sheets labeled with a large black “T” ○ 4 sheets labeled with a large black “3 prime end” ○ 4 sheets labeled with a large black “5 prime end” • 20 sheets of 8 1/2 “ by 11” pink paper representing nucleotides ○ 10 sheets labeled with a large black “A” ○ 10 sheets labeled with a large black “C” ○ 10 sheets labeled with a large black “G” ○ 10 sheets labeled with a large black “T” • Roll of tape Procedure & Inquiry 1. Call two students to the front of the room. 2. Tell the students to build the following DNA sense strand by taping the white nucleotide papers on the board keeping in the mind the 3’ and 5’ ends: AACGTACCGCTATCT 3. Then have the class tell the students to build the complementary strand of DNA using the pink paper. 4. Now have the class instruct the students to replicate the strand. Tell them that they must take into account the 3’ and 5’ ends of the nucleotides. 5. Have the class evaluate if the replicated strands are correct and represented semi-discontinuous and semiconservative replication. B. Virtual DNA Replication Concept Map Introduction This fun and fast way to build a concept map engages students in developing a scheme for reviewing all the facts and concepts associated with DNA replication. It helps student select relevant information needed to understand DNA replication. In addition, it helps them incorporate concepts learned in other sections of the book that contribute to an understanding of DNA replication. The simple click and drag animated concept mapping tool should be practiced before using in class. Materials • Computer with live access to Internet • LCD projector attached to computer • Web browser with bookmark to Michigan State University C-Tool: http://ctools.msu.edu/ctools/index.html Procedure & Inquiry 1. Tell students that you would like to do a quick review of the concepts associated with DNA replication. 2. Then go to the Michigan State University C-Tool and add the concept map term “DNA Replication”. Use the “Add” and “Concept Word” feature to place a term on the map background. 3. Solicit a few more terms or concepts and then ask the class how the concepts are connected to each other. Use the “Add” and “Linking Line” feature to build a connecting line. 4. Then ask the students to justify the concept linking lines. Use the “Add” and “Linking Word” feature to place student comments on the map. 5. Continue the activity until you feel the students made a comprehensive map. LABORATORY IDEAS This activity teaches students to use the initial investigations of Watson and Crick in building a structurally correct model of DNA. They designed a theoretical model of DNA by using cardboard to build different DNA structures. It is a good critical thinking activity that promotes an understanding of the use of models in answering scientific questions. a. Tell students that you would like them to design a model of DNA that demonstrates the chemistry of a double DNA strand. It is important to stress that they must take into account bonding and the shapes of the nucleic acids. b. The following materials should be provided to a small group of students: a. Scissors b. Markers c. A roll of cellophane tape d. A roll of Velcro-type adhesive tape e. Construction paper f. Small polystyrene balls g. Toothpicks h. Images of nucleic acids c. Have the students explain their models d. Then have the class briefly evaluate the various group models for accuracy LEARNING THROUGH SERVICE Service learning is a strategy of teaching, learning and reflective assessment that merges the academic curriculum with meaningful community service. As a teaching methodology, it falls under the category of experiential education. It is a way students can carry out volunteer projects in the community for public agencies, nonprofit agencies, civic groups, charitable organizations, and governmental organizations. It encourages critical thinking and reinforces many of the concepts learned in a course. 1. Have students do a presentation on the history of genetics to a civic group. 2. Have students design an educational PowerPoint presentation on DNA structure and replication for middle school teachers. 3. Have students tutor middle school or high school biology students studying genetics. 4. Have students design and build an accurate DNA model for a local school or library. ETYMOLOGY OF KEY TERMS -ase enzyme (modern) -gen that which produces (from the Greek genes- born or produced) phago eating; devouring (from the Greek phagein- to eat) polymer- a chemical compound having many parts (from the Greek polysmany and meros- part) prote- of, or relating to, protein; first (from the Greek protos- first) senescent old (from the Latin senescens, present participle of senescere- to grow old) transform to change in form or composition (from the Latin trans- across or through and formare- to form) apoptosis programmed cell death (from the Greek apo- away from and piptein- to fall) chimeric a female monster composed of many animal parts: a lion’s head, a goat’s body and a snake’s tail (from the Greek chimaria- female goat) germ beget (from the Latin gignere- to beget) neutro- neutral; having no charge or affiliation (from the Latin neuterneither) onco- tumor (from the Greek onkos- bulk) proto- first (from the Greek protos- first) sarcoma connective tissue tumor (from the Greek sarkoun- to grow flesh) somat- the body of an organism (from the Greek soma- body) CHAPTER 15: GENES AND HOW THEY WORK WHERE DOES IT ALL FIT IN? Chapter 15 takes the information on DNA structure and function in Chapter 14 and uses it to explain gene expression. It is critical that students have a good understanding of nucleotides before proceeding with Chapter 15. So, it is important that students have a fresh understanding of Chapters 12 and 13 before moving into gene expression. The concepts in Chapter 15 are essential for understanding natural selection and development. SYNOPSIS The current model of heredity states that individual genes on chromosomes code for particular polypeptides, which are then assembled into complex proteins. This is basically a two-step process with the DNA coding for various forms of RNA, which are then used to produce a polypeptide. There are three general classes of RNA derived from DNA; messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA). The first step, DNA to RNA, is called transcription. The language of the molecules is basically the same (excluding the substitution of uracil for thymine), the product is mRNA. The second step, RNA to protein, is called translation. There is a change in language from the nucleic acid sequence of the RNA to the amino acid sequence of the protein product. All three RNAs are involved in this process; mRNA is the blueprint, rRNA is the assembly line machinery, and tRNA is the robot that delivers the amino acids from the supply room to the assembly line. Both transcription and translation are ultimately controlled by various assembly enzymes that recognize specific nucleotide sequences. The genetic code that translates base pair sequence into amino acid sequence was deciphered by several researchers, including Crick. Crick postulated that each letter of the code was a block of three nucleotides, called a codon. Experimental data confirmed this and indicated that the code was a simple linear arrangement not punctuated by intervening nucleotides. Each of the 64 possible codons codes for a particular amino acid, a start or a stop signal. A few amino acids are represented by several codons, while others are represented by only one or two. Individual activating enzymes recognize certain short sequences in a specific region of the tRNA. Alteration of these sequences attaches an amino acid other than that associated with its anticodon onto the tRNA. The genetic code is almost universal. Except for a few exceptions, all organisms use the same genetic code. Transcription, preparing the mRNA blueprint from the master DNA information, is completely dependent on the complex molecule RNA polymerase. Unlike DNA replication, RNA transcription does not require any primer. There are three main steps to transcription: initiation, elongation, and termination. RNA polymerase recognizes a specific site on the coding strand of DNA and causes the double helix to unwind forming a transcription bubble. The transcription bubble travels down the length of the gene until an appropriate stop signal is reached and transcription is terminated. Unlike DNA replication, RNA transcription has no proofreading capabilities. In eukaryotes, the initial RNA transcript is modified before it leaves the nucleus. These modifications include addition of a 5’ cap, 3’ tail and removal of intervening sequences, known as introns. With the knowledge gained from the Human Genome Project, it is apparent that introns may be removed in different patterns depending on the cells expressing the gene. This phenomenon is alternative splicing. The mechanism of protein synthesis is controlled by several enzymes and initiation factors that accurately place the mRNA within the rRNA of the ribosome. Positioning is critical throughout the process to ensure proper reading of the sequences so the polypeptide is made correctly. The ribosome moves along the mRNA sequentially, reading the codon and adding a new amino acid to the growing chain. When a stop signal is reached, the entire complex disassociates its components free to be used elsewhere. LEARNING OUTCOMES 15.1 Experiments Have Revealed the Nature of Genes 1. Describe the evidence supporting the “one gene-one polypeptide” hypothesis. 2. Explain how the central dogma of molecular biology relates to the flow of information in cells. 15.2 The Genetic Code Relates Information in DNA and Protein 1. Predict the results of deleting or adding one, two, or three DNA bases. 2. Describe the features of the genetic code. 15.3 Prokaryotes Exhibit All the Basic Features of Transcription 1. Describe the transcription process in bacteria, identifying its unique features. 15.4 Eukaryotes Use Three Polymerases, and Extensively Modify Transcripts 1. Explain how the three eukaryotic RNA polymerases differ in their functions. 2. Contrast initiation of transcription in eukaryotes and prokaryotes. 3. Describe how eukaryotic RNA transcripts are modified. 15.5 Eukaryotic Genes May Contain Noncoding Sequences 1. Explain how the spliceosome processes a primary transcript. 2. Explain how eukaryotes can produce many more proteins than they have genes. 15.6 The Ribosome Is the Machine of Protein Synthesis 1. Describe how the two ends of a tRNA differ functionally. 2. Explain why activating enzymes are said to be the cell’s translators of the genetic code. 3. Differentiate between the functions of different tRNA binding sites on the ribosome. 15.7 The Process of Translation is Complex and Energy-Expensive 1. Contrast initiation in prokaryotes and eukaryotes. 2. Indicate in what order the A, E, and P sites of a ribosome are occupied by each tRNA. 3. Compare translation on the RER to that in the cytoplasm. 15.8 Mutations Are Alterations in the Sequence, Number, or Position of Genes 1. Contrast the different kinds of point mutations. 2. Compare the different kinds of chromosomal mutations. Summary • The process of gene expression converts information in the genotype into the phenotype. • A copy of the gene in the form of mRNA is produced by transcription, and the mRNA is used to direct the synthesis of a protein by translation. • Both transcription and translation can be broken down into initiation, elongation, and termination cycles that produce their respective polymers. (The same is true for DNA replication.) • Eukaryotic gene expression is much more complex than that of prokaryotes COMMON STUDENT MISCONCEPTIONS There is ample evidence in the educational literature that student misconceptions of information will inhibit the learning of concepts related to the misinformation. The following concepts covered in Chapter 15 are commonly the subject of student misconceptions. This information on “bioliteracy” was collected from faculty and the science education literature. • Students think that DNA works independently to control the cell • Students do not fully understand the role of genetics and environment on determining observable variation in organisms • Students think all genes code for proteins • Students believe that genes somehow contain all the information for a trait • Students confuse the terms transcription and translation • Students do not distinguish between prokaryotic and eukaryotic gene expression • Students believe tRNA fits perfectly on the mRNA triplet • Students believe that mRNA can only be produced from the sense strand • Students believe that the cell uses both DNA strands for transcription in eukaryotes • Students do not equate pre-mRNA with the presence of introns • Students believe that prokaryotes carry out pre-mRNA processing • Students believe that ribosomes have a passive role in translation • Students think that all mutations are bad • Students think that all mutations greatly disrupt the nucleotide sequence • Students think nondisjunctions are the only type of chromosome aberration INSTRUCTIONAL STRATEGY PRESENTATION ASSISTANCE Students may become confused with the three terms: transcription, translation, and translocation. It is important to use the entire word and not shorthand when presenting the material to the students. Also, describing the rationale behind the names is useful. Transcription is essentially a process not unlike copying a set of class notes, whether by hand or by machine. There is a slight difference between the original and the copy; the original notes may be written in blue pen, the photocopy is composed of dark black carbon deposits. In the cell, the original is double-stranded DNA containing thymine, the copy is single-stranded mRNA containing uracil. Messenger RNA is simply a copy of the cell’s blueprint for a protein. The cell doesn’t use its original set of instructions for the same reasons that a carpenter wouldn’t take the original building blueprints to the work site – they need to remain intact and readable. Also, many different workers need to use blueprint copies at the same time to do all different sorts of construction, often in different locations in the building. Similarly transcription of mRNA allows many different kinds of protein synthesis to occur at the same time; the DNA is not held to making only one protein at a time. Translation, on the other hand, is not a simple copying process. One language, that of the sequence of nucleotides that compose the RNA, is changed into an entirely different language, that of the sequence of amino acids that comprises polypeptides and therefore, protein structure. This is not unlike the process of translating English into Chinese. Wholly different words and symbols are exchanged for one another yet the same meaning is conveyed by both. Fortunately there are fewer semantic discrepancies in biological translation as each codon stands for only one specific amino acid. It makes sense that DNA replication requires a proofreading mechanism while mRNA transcription does not. DNA replication is like printing a bound copy of a book, the process is expensive and the product must be accurate without mistakes or changes. Transcription is a cheap photocopy process. Many copies are made quickly and easily. If a few copies don’t turn out too well, just throw them in the trash! If the RNA transcript is damaged and doesn’t work – no big deal, there’s another floating around. But if the DNA copy is altered from the original, the whole existence of the cell may be compromised. If one looks at protein synthesis as a collection of subassemblies of various molecules, it is much easier to understand. Henry Ford didn’t invent the assembly line, cells did. The ribosome is the construction site for protein synthesis. The ER is analogous to the truck or rail system that moves the product from the assembly line to where it is needed. If you expect your students to be able to identify the A site and the P site on the ribosome, remind them that the A site is the location where the tRNA with the single amino acid attaches. The P site is the spot where the tRNA with the polypeptide chain is located. Obviously the E site is the exit. When discussing the genetic code (i.e., table 15.1), point out that where there are two or more codons that specify a single amino acid, the variation is usually in the third nucleic acid. Leucine and arginine are exceptions with variation in the first and third letters, the former being coded for by CU(UCAG) and UU(AG), the latter coded by CG(UCAG) and AG(AG). The amino acid assembly within the ribosome is not a difficult process if compared to constructing a chain from individual links. One could lay out all the links in appropriate order and then construct a long pinching apparatus that would put them all together at once. This would be fine if all the chains this machine ever produces are the same length (or shorter). A biological machine of this sort would have to be thousands of pinchers long, as long as the longest polypeptide, a real waste to have around to produce mostly short polypeptides. A smaller device could put short batches together and link them one by one, but there would be greater chance for error with this process. The easiest way to do it is the way the cell does it. Only two links are important at a time, the one connected to the rest of the chain and the one being added. A long polypeptide can be assembled just as readily as a short one and the chance for assembly errors are much reduced. Translocation is simply the process of moving the last end of the chain from one hand to the next so a new link can be grabbed out of the appropriate box. HIGHER LEVEL ASSESSMENT Higher level assessment measures a student’s ability to use terms and concepts learned from the lecture and the textbook. A complete understanding of biology content provides students with the tools to synthesize new hypotheses and knowledge using the facts they have learned. The following table provides examples of assessing a student’s ability to apply, analyze, synthesize, and evaluate information from Chapter 15.
Application • Have students predict the mRNA and codon sequence of a DNA strand ATTCGCCCATTATCCCC. • Have students determine the possible DNA sequence of a peptide composed of lysine-tyrosine-methonine-leucine-lysine. • Ask students investigate the effects on a protein if the third thymine is removed from the sequence CTCACGGCATTACGCCCG
Analysis • Have students explain the various effects on a cell if adenine was replaced by a cytosine in the DNA sequence. • Ask students to determine the safety to humans of antibacterial drugs that interfere with translation in bacteria. • Ask students to explain the possible outcomes of a genetic disease that prevents certain spliceosomes from working.
Synthesis • Ask students determine the effects on a cell after large amounts of mRNA from its complementary strand are introduced into the cell. • Have students describe the nature of a drug that would interfere with protein synthesis in eukaryotes without harming prokaryotes. • Ask students come up use a technique that induces specific frameshift mutations in a particular gene.
Evaluation • Ask students to evaluate the limitations of trying to express eukaryotic DNA in a prokaryote. • Ask students evaluate the effectiveness of anticancer drugs that interfere with specific RNA polymerases. • Ask to research the pros and cons of a medical treatment called RNA interference therapy.
VISUAL RESOURCES A variety of visuals are possible for this material, many mentioned above in terms of machine-oriented analogies. With enough time, effort, raw materials, and perhaps assistance from the mechanical engineering department, an interesting working model could be constructed. For many students, animations are extremely helpful. It is hard to understand the process when only presented with words and still pictures. To actually see the ribosome moving down the mRNA and various tRNA coming into place makes the process much easier to understand for many students. IN-CLASS CONCEPTUAL DEMONSTRATIONS A. Replicating Students – Eukaryotic Gene Expression Introduction This fun and fast demonstration engages students in demonstrating the process of gene expression. It uses student input to design the sequence the events of protein synthesis in prokaryotes and eukaryotes. Materials • 4 Student volunteers • Overhead display of a anti-codon chart with the appropriate amino acids • 1 large t-shirt labeled ribosome • Large black marker • 48 sheets of 8 1/2 “ by 11” white paper representing DNA nucleotides ○ 10 sheets labeled with a large black “A” ○ 10 sheets labeled with a large black “C” ○ 10 sheets labeled with a large black “G” ○ 10 sheets labeled with a large black “T” ○ 4 sheets labeled with a large black “3 prime end” ○ 4 sheets labeled with a large black “5 prime end” • 20 sheets of 8 1/2 “ by 11” pink paper representing RNA nucleotides ○ 10 sheets labeled with a large black “A” ○ 10 sheets labeled with a large black “C” ○ 10 sheets labeled with a large black “G” ○ 10 sheets labeled with a large black “T” • 4 sheets of 8 1/2 “ by 11” green paper ○ 1 sheet labeled RNA polymerase ○ 1 sheet labeled primer ○ Spliceosome ○ Transfer RNA • 10 index cards. • 10 sheets of 8 1/2 “ by 11” yellow paper labeled tRNA • Roll of tape Procedure & Inquiry 1. Call four students to the front of the room. 2. Have one student where the t-shirt and play the role the ribosome. 3. Assign another student to hold the marker, tape, index cards, and tRNA papers. Their role is build the appropriate tRNA needed for translation. 4. Tell the students to build the following DNA sense strand by taping the white nucleotide papers on the board keeping in the mind the 3’ and 5’ ends: AACGTACCGCTATCTCTATCT 5. Then have the class tell the students to carry out transcription using the RNA pink paper. 6. Now have the class instruct the students to proceed to translation. 7. Have the class evaluate if the process was carried out correctly and ask them how prokaryotic replication would differ. B. Virtual Gene Expression Concept Map Introduction This fun and fast way to build a concept map engages students in developing a scheme for reviewing all the facts and concepts associated with gene expression It helps student select relevant information needed to understand prokaryotic and eukaryotic protein syntheis. The simple click and drag animated concept mapping tool should be practiced before using in class. Materials • Computer with live access to Internet • LCD projector attached to computer • Web browser with bookmark to Michigan State University C-Tool: http://ctools.msu.edu/ctools/index.html Procedure & Inquiry 1. Tell students that you would like to do a quick review of the concepts associated with gene expression and mutation 2. Then go to the Michigan State University C-Tool and add the concept map term “Gene Expression”. Use the “Add” and “Concept Word” feature to place a term on the map background. 3. Solicit a few more terms or concepts and then ask the class how the concepts are connected to each other. Use the “Add” and “Linking Line” feature to build a connecting line. 4. Then ask the students to justify the concept linking lines. Use the “Add” and “Linking Word” feature to place student comments on the map. 5. Continue the activity until you feel the students made a comprehensive map. LABORATORY IDEAS Database Lab – Chernobyl Swallows Studies on the environmental causes of mutations use simple statistical analyses on databases to look for changes in mutation rates. This investigation provides students with the means to perform a trend analysis to investigate the link between radioactive contamination and an increase in mutations in wildlife populations. a. Introduce the concept of databases to students. Tell them that they contain information that may or may not be useful for particular types of analyses. b. Then discuss that databases are being used to investigate the effects of radioactive contamination from the Chernobyl nuclear power facility causing mutations in wildlife even years after what was considered the world's worst nuclear power accident occurred in 1986. c. Provide students with the following: a. Barn swallow data on collected by Tim Mousseau, of the University of South Carolina, and Anders Moller, of the France University of Pierre et Marie Curie in France. b. Internet access. c. Access to statistics books or websites where they can look up the meaning of standard deviation and other statistical analysis concepts. d. Access to statistical software or calculators if desired. d. Tell the class to see if they can find any evidence that could indicate an increase in mutations among the barn swallows in Chernobyl. Provide them with the following inquiry questions and tasks: a. Have the students look up the proximity of Chernobyl to Kanev and Denmark. b. They should also be asked to research the possibility of radiation contamination from the Chernobyl nuclear power facility reaching those areas. c. Have the students research the types of mutations generated by exposure to nuclear radiation. d. Have the students identify any features that appear to be significantly different in the Chernobyl animals compared to the others. e. Ask the students to come up with ways that they could determine through experimentation if any the changes in mutation rate that they identified could be associated with the Chernobyl incident. e. In conclusion students should see evidence of mutational changes due to the Chernobyl incident. Mousseau and Moller’s reviews of other research showed that more than 20 species that show genetic damage as a consequence of Chernobyl contaminants. There study was the first systematic review of the genetic consequences of low dose radiation in a natural environment and suggests that such damage may be extensive. f. Data Tables: Data from: Møller, A. P., and T. A. Mousseau. 2003. Mutation and sexual selection: A test using barn swallows from Chernobyl. Evolution, 57: 2139-2146. http://cricket.biol.sc.edu/chernobyl/papers/moller-mousseau-evolution-2003.pdf LEARNING THROUGH SERVICE Service learning is a strategy of teaching, learning and reflective assessment that merges the academic curriculum with meaningful community service. As a teaching methodology, it falls under the category of experiential education. It is a way students can carry out volunteer projects in the community for public agencies, nonprofit agencies, civic groups, charitable organizations, and governmental organizations. It encourages critical thinking and reinforces many of the concepts learned in a course. 1. Have students do a presentation for children on genes for elementary school children or youth civic groups. 2. Have students design an educational PowerPoint presentation on protein synthesis for middle school teachers. 3. Have students tutor middle school or high school biology students studying genetics. 4. Have students design a display on gene expression for a school library. ETYMOLOGY OF KEY TERMS -ase enzyme (modern) Peptide compound containing two or more amino acids (modern derivative of peptic and pepsin, which is from the Greek peptikos- conducive to digestion) poly- many (from the Greek polys- many) promoter a binding site in DNA where transcription begins (from the Latin pro- forward and movere- to move) some body (from the Greek soma- body) transcription the process of an RNA molecule using the information in a gene (from the Latin trans- across or through and scribere- to write) translation the process of synthesizing a polypeptide (from the Latin trans across or through and latus, past participle of ferre- to carry) Instructor Manual for Understanding Biology Kenneth Mason, George Johnson, Jonathan Losos, Susan Singer 9780073532295, 9781259592416
Download
Close
Close
